pCru5-UCU/ACC-mEGFP-IRES-mCherry
(Plasmid #49223)

• Purpose: Retroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.
• Depositing Lab: Clifford Wang
• Publication: Ferreira et al Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11284-9. doi: 10.1073/pnas.1305590110. Epub 2013 Jun 24.

Backbone

• Vector backbone: pCru5
• Total vector size (bp): 6983
• Vector type: Mammalian Expression, Retroviral, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mEGFP
• Species: Synthetic
• Insert Size (bp): 732
• Promoter: Viral LTR (or CMV)
• Tag / Fusion Protein:
  • SfuI site to create C-terminal fusions (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: GGATACACGCCGCCCACGTG (5' to 3')
• 3′ sequencing primer: AGGGCGAGGGCGATGCCACCTA (5' to 3')

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: Viral LTR (or CMV)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GTCACCTTCAGCTTGGCGG (5' to 3')
• 3′ sequencing primer: ATGGCGTTACTTAAGCTAG (5' to 3')

Resource Information

• Supplemental Documents:
  • pCru5-UCU/ACC-mEGFP-IRES-mCherry

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.