pTriEx4-H6-FGB
(Plasmid #49203)

• Purpose: Fluorescent reporter for cGMP
• Depositing Lab: John Garthwaite
• Publication: Bhargava et al Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026.

Backbone

• Vector backbone: pTriEx4
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5238
• Total vector size (bp): 6768
• Modifications to backbone: PshA I site was used at 5' direction for inserting the insert into vector. This site was lost after ligation.
• Vector type: Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H6-FGB
• Alt name: CR4Ex
• Species: B. taurus (bovine); GFP
• Insert Size (bp): 1764
• Mutation: None
• Promoter: CMV
• Tag / Fusion Protein:
  • His tag + Other tags (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PshA I (destroyed during cloning)
• 3′ cloning site: Not I (not destroyed)
• 5′ sequencing primer: CCGGAGTTAATCCGGGACCT
• 3′ sequencing primer: None

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Prof. Wolfgang Dostmann at University of Vermont, USA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

http://www.pnas.org/content/105/1/365.long