pEGFP-N1-FNIP1
(Plasmid #49175)

• Purpose: Mammalian expression of mouse folliculin interacting protein 1 (FNIP1) fused to GFP
• Depositing Lab: Shawn Ferguson
• Publication: Petit et al J Cell Biol. 2013 Sep 30;202(7):1107-1122.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 8351
• Modifications to backbone: None
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Folliculin Interacting Protein 1
• Alt name: FNIP1
• Species: M. musculus (mouse)
• Insert Size (bp): 3495
• Mutation: Stop codon deleted
• GenBank ID: BC001956.1
• Entrez Gene: Fnip1 (a.k.a. A730024A03Rik)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry