pEGFP-N1-FLCN
(Plasmid #49173)

• Purpose: Mammalian expression of mouse folliculin (FLCN) fused to GFP
• Depositing Lab: Shawn Ferguson
• Publication: Petit et al J Cell Biol. 2013 Sep 30;202(7):1107-1122.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 6609
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Folliculin
• Alt name: FLCN
• Species: M. musculus (mouse)
• Insert Size (bp): 1737
• Mutation: Stop codon deleted
• GenBank ID: BC015687.2
• Entrez Gene: Flcn (a.k.a. B430214A04Rik, Bhd, FLCL)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry