pMT3-FLAG-KLF3
(Plasmid #49102)

• Purpose: Expresses KLF3 in mammalian cells
• Depositing Lab: Merlin Crossley
• Publication: Himeda et al Mol Cell Biol. 2010 Jul;30(14):3430-43. doi: 10.1128/MCB.00302-10. Epub 2010 Apr 19.

Backbone

• Vector backbone: pMT3
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 1035
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Krüppel-Like Factor 3(KLF3)
• Alt name: BKLF
• Species: M. musculus (mouse)
• Insert Size (bp): 1035
• GenBank ID: NC_000071.6
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GACAATGACATCCACTTTGC
• 3′ sequencing primer: CGTCAAGTTTGGCGCGAAAT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry