pEF5B-FRT-AP-Smo-YFP-DEST
(Plasmid #49099)

• Purpose: Expressing AP-Smo-YFP in mammalian cells, can be used for establishing Flp-In stable cell lines
• Depositing Lab: Maxence Nachury
• Publication: Ye et al Elife. 2013 Aug 6;2:e00654. doi: 10.7554/eLife.00654. Print 2013.

Backbone

• Vector backbone: pEF5B
• Backbone size w/o insert (bp): 6833
• Total vector size (bp): 8350
• Modifications to backbone: Gateway Cloning DEST vector from Life Technologies
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Mach T1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Smo
• Alt name: Smoothened
• Species: M. musculus (mouse)
• Insert Size (bp): 2408
• Entrez Gene: Smo (a.k.a. E130215L21Rik, Smoh, bnb, smoothened)
• Promoter: T7
• Tags / Fusion Proteins:
  • acceptor peptide (AP) (N terminal on insert)
  • YFP (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ATGGCCGCTGGCCGCCCC
• 3′ sequencing primer: CTACAGCTCGTCCATGCCGAGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: AP-SMO-YFP was a gift from Dr. Carolyn Ott in Jennifer Lipincott-Schwartz lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry