-
PurposeAdeno-associated virus (AAV) encoding a green fluorescent protein/Cre recombinase (GFP/Cre) fusion protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneadeno-associated viral (AAVsp)
- Backbone size w/o insert (bp) 6165
- Total vector size (bp) 8002
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre
-
Alt nameGFP-NLS-Cre
-
Alt namegreen fluorescent protein Cre recombinase (GFP/Cre) fusion protein
-
SpeciesM. musculus (mouse); Aequorea victoria green
-
Insert Size (bp)1837
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- Myc (N terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmlI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer tagccacaccagccaccact
- 3′ sequencing primer caacgtgctggtctgtgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Encodes an N-terminal GFP, Myc-tag fused in-frame to an SV40 nuclear localization signal (NLS) and Cre recombinase (AAV-GFP/Cre).
Expression is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs). High titer, purified virus prepared from this plasmid can be used for stereotaxic injection into adult ROSA26 reporter mice.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-GFP/Cre was a gift from Fred Gage (Addgene plasmid # 49056 ; http://n2t.net/addgene:49056 ; RRID:Addgene_49056) -
For your References section:
Adeno-associated virus effectively mediates conditional gene modification in the brain. Kaspar BK, Vissel B, Bengoechea T, Crone S, Randolph-Moore L, Muller R, Brandon EP, Schaffer D, Verma IM, Lee KF, Heinemann SF, Gage FH. Proc Natl Acad Sci U S A. 2002 Feb 19;99(4):2320-5. Epub 2002 Feb 12. 10.1073/pnas.042678699 PubMed 11842206