AAV GFP
(Plasmid #49055)

• Purpose: adeno-associated virus (AAV) encoding a green fluorescent protein
• Depositing Lab: Fred Gage
• Publication: Kaspar et al Proc Natl Acad Sci U S A. 2002 Feb 19;99(4):2320-5. Epub 2002 Feb 12.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: adeno-associated viral (AAVsp)
• Backbone size w/o insert (bp): 6204
• Total vector size (bp): 7074
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Alt name: Enhanced Green Fluorescent Protein
• Species: Aequorea victoria green
• Insert Size (bp): 720
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: tagccacaccagccaccact
• 3′ sequencing primer: caacgtgctggtctgtgtg

Resource Information

• Supplemental Documents:
  • AAV sp map
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression of GFP is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs).