CAG-GFP/cre
(Plasmid #49054)

• Purpose: Retroviral vector contains CAG promoter , CMV enhancer and a large synthetic intron that used to allow the ubiquitous expression of GFP-fused Cre recombinase
• Depositing Lab: Fred Gage
• Publication: Tashiro et al Nat Protoc. 2006;1(6):3049-55.

Backbone

• Vector backbone: CAG-GFP
• Backbone manufacturer: Gage lab (Addgene plasmid# 16664)
• Backbone size w/o insert (bp): 6817
• Total vector size (bp): 8681
• Modifications to backbone: vector backbone based on the pCL system by Naviaux et al.,J. Virol. 70, 5701–5705 (1996).
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP/Cre
• Alt name: GFP-fused Cre recombinase
• Species: Synthetic
• Insert Size (bp): 1870
• GenBank ID:
• Promoter: CAG

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTC GGC AAC GTG CTG GTT GTT
• 3′ sequencing primer: CAACATAGTTAAGAATACCAGTC

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry