Skip to main content
Addgene

3xFNLDD/pMXs-IG
(Plasmid #48972)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48972 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs-IG
  • Backbone manufacturer
    Toshio Kitamura
  • Backbone size w/o insert (bp) 5994
  • Total vector size (bp) 6741
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    enhanced GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xFNLDD
  • Alt name
    3xFLAG-NLS-LexA binding domain
  • Species
    Synthetic
  • Insert Size (bp)
    747
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xFLAG tag (N terminal on insert)
    • NLS (nuclear localization signal) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Stu I (destroyed during cloning)
  • 3′ cloning site Stu I (destroyed during cloning)
  • 5′ sequencing primer ggtggaccatcctctagact
  • 3′ sequencing primer AAACGCACACCGGCCTTATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFNLDD/pMXs-IG was a gift from Hodaka Fujii (Addgene plasmid # 48972 ; http://n2t.net/addgene:48972 ; RRID:Addgene_48972)
  • For your References section:

    A Critical Role of the Thy28-MYH9 Axis in B Cell-Specific Expression of the Pax5 Gene in Chicken B Cells. Fujita T, Kitaura F, Fujii H. PLoS One. 2015 Jan 21;10(1):e0116579. doi: 10.1371/journal.pone.0116579. eCollection 2015. PONE-D-14-45451 [pii] PubMed 25607658