Skip to main content

sgRNA with rpr-1 promoter
(Plasmid #48961)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48961 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMA-T
  • Backbone manufacturer
    life technologies
  • Vector type
    Worm Expression, CRISPR
  • Promoter rpr-1 promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer acaaaaaggctcagcctcaacc
  • 3′ sequencing primer tttgaaattttgagtgaggctcagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgRNA with rpr-1 promoter was a gift from Mario de Bono (Addgene plasmid # 48961 ; http://n2t.net/addgene:48961 ; RRID:Addgene_48961)
  • For your References section:

    Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Chen C, Fenk LA, de Bono M. Nucleic Acids Res. 2013 Sep 5. 10.1093/nar/gkt805 PubMed 24013562