pEGFP-AQP9
(Plasmid #48808)

• Purpose: Express human AQP9, which induces filopodia formation
• Depositing Labs: Kenneth Jacobson, Vesa Loitto
• Publication: Loitto et al Exp Cell Res. 2007 Apr 15;313(7):1295-306. Epub 2007 Feb 8.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5610
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AQP9
• Alt name: Aquaporin 9
• Species: H. sapiens (human)
• Insert Size (bp): 888
• GenBank ID: NM_020980
• Entrez Gene: AQP9 (a.k.a. AQP-9, HsT17287, SSC1, T17287)
• Tag / Fusion Protein:
  • eGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: atcacatggtcctgctggag

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry