pLenti-CamkII-MacQ-mOrange2
(Plasmid #48761)

• Purpose: sensor
• Depositing Lab: Mark Schnitzer
• Publication: Gong et al Nat Commun. 2014 Apr 22;5:3674. doi: 10.1038/ncomms4674.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10866
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: macQ-mOrange
• Species: L. maculans
• Insert Size (bp): 1626
• Mutation: mac-D139Q
• Promoter: CamKIIa

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctgacgaaggctcgcgaggc
• 3′ sequencing primer: gccatacgggaagcaatagcatg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: the full sequence does not include the noted mac-D139Q mutation. This mutation was confirmed in the Addgene QC sequence.