pTAL7a
(Plasmid #48705)

• Purpose: (Empty Backbone) TALEN expression in mammalian cells
• Depositing Lab: Boris Greber
• Publication: Frank et al BMC Genomics. 2013 Nov 9;14(1):773.

Backbone

• Vector backbone: pZErO-2
• Backbone manufacturer: Invitrogen
• Backbone size (bp): 8222
• Vector type: Mammalian Expression, TALEN
• Promoter: CAG
• Selectable markers: Puromycin ; GFP
• Tag / Fusion Protein:
  • FokI nuclease (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: CGCTTGGAGGAATGCTCTGA
• 3′ sequencing primer: AAGCGAGAGCGACCAGATGAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The truncated TALE backbone and FokI wild-type sequences were PCR-amplified from plasmid pCAG-TAL-linker-IX_Fokwt kindly provided by Dr. Ralf Kühn.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Article describing generation and use of this plasmid is currently in revision