Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CeCollectrin-like pXOOM
(Plasmid #48704)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48704 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXOOM
  • Backbone size w/o insert (bp) 5052
  • Total vector size (bp) 5478
  • Vector type
    Mammalian Expression ; Xenopus Oocyte Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NM_058858
  • Species
    C. elegans (nematode)
  • Entrez Gene
    C50F2.7 (a.k.a. CELE_C50F2.7)
  • Promoter t7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ATGAGACTTTCCGTTTTATTCT
  • 3′ sequencing primer TCACTGATACGCAGTGTATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original plasmid backbone (pXOOM) was donated by the laboratory of Dr. Thomas Jespersen from the University of Copenhagen, Denmark.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CeCollectrin-like pXOOM was a gift from Dmitri Boudko (Addgene plasmid # 48704 ; http://n2t.net/addgene:48704 ; RRID:Addgene_48704)