-
PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
- Total vector size (bp) 4406
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
-
SpeciesSynthetic
-
Insert Size (bp)887
- Promoter Sp6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer SP
- 3′ sequencing primer M13pUC-fwd (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
M-tdTom-NM was a gift from George Church (Addgene plasmid # 48679 ; http://n2t.net/addgene:48679 ; RRID:Addgene_48679) -
For your References section:
Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. 10.1038/nmeth.2681 PubMed 24076762