Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUSB4_TTTT
(Plasmid #48623)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48623 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUS_B4
  • Vector type
    Mammalian Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RVD sequence: NG NG NG NG
  • Species
    Synthetic

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttgatgcctggcagttccct
  • 3′ sequencing primer cgaaccgaacaggcttatgt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid was created using Golden Gate cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUSB4_TTTT was a gift from Stephen Ekker (Addgene plasmid # 48623 ; http://n2t.net/addgene:48623 ; RRID:Addgene_48623)
  • For your References section:

    High Efficiency In Vivo Genome Engineering with a Simplified 15-RVD GoldyTALEN Design. Ma AC, Lee HB, Clark KJ, Ekker SC. PLoS One. 2013 May 29;8(5):e65259. doi: 10.1371/journal.pone.0065259. Print 2013. 10.1371/journal.pone.0065259 PubMed 23734242