pDS66
(Plasmid
#48364)
-
Purpose3XHA-intergenic region of TUB-HYG (modified from PMID 16269191)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEM-T Easy
-
Backbone manufacturerPromega
- Total vector size (bp) 4500
-
Vector typeCre/Lox ; Knockout in T. Brucei
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3XHA-intergenic region of TUB-HYG (modified from PMID 16269191)
-
SpeciesT. brucei
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
- 3′ sequencing primer pBRrevBam (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDS66 was a gift from George Cross (Addgene plasmid # 48364 ; http://n2t.net/addgene:48364 ; RRID:Addgene_48364) -
For your References section:
Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366