pHJ22
(Plasmid #48358)

• Purpose: Targets beta-Tubulin for Cre-lox mediated knockout in T. brucei, Neomycin/Gancyclovir selectable
• Depositing Lab: George Cross
• Publication: Kim et al Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001.

Backbone

• Vector backbone: pHD309
• Backbone manufacturer: Cross Lab
• Total vector size (bp): 6092
• Vector type: Cre/Lox ; Knockout in T. Brucei
• Selectable markers: Neomycin (select with G418) ; Gancyclovir

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-NEO-Ty1-TK-loxP-3' ALD UTR
• Species: T. brucei

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tb#44 CTGGTTAGTATGGACTTCTCTAGA
• 3′ sequencing primer: pBRrevBam

Resource Information

• Supplemental Documents:
  • pHJ22 GenBank

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.