Skip to main content
Addgene

pSY45
(Plasmid #48355)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48355 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pyrFEKO-HYG
  • Backbone manufacturer
    Cross Lab
  • Total vector size (bp) 7015
  • Vector type
    Cre/Lox ; Knockout in T. Brucei
  • Selectable markers
    Hygromycin ; Gancyclovir

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    loxP-SAS-HYG-Ty1-TK-loxP flanked by TbMCM-BP-targeting homologies
  • Species
    T. brucei

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
  • 3′ sequencing primer pBRrevBam
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

Addgene's sequence with primer Hygro-R shows several mismatches within the TbMCM-BP 5' homology arm as well as other small changes compared to the depositor's reference sequence. These changes should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSY45 was a gift from George Cross (Addgene plasmid # 48355 ; http://n2t.net/addgene:48355 ; RRID:Addgene_48355)

  • For your References section:

    Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366
Related items:
Commonly requested with: