pTrex-Luc-Neo
(Plasmid #48336)

• Purpose: Trasgenically expresses firefly luciferase in T. cruzi with neomycin selection
• Depositing Lab: Rick Tarleton
• Publication: Sanchez-Valdez et al Elife. 2018 Mar 26;7. pii: 34039. doi: 10.7554/eLife.34039.

Backbone

• Vector backbone: pTrex
• Backbone manufacturer: Martin P. Vazquez
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 7900
• Modifications to backbone: Luciferase inserted in MCS through HindIII and XhoI.
• Vector type: Trypanasoma cruzi expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: firely luciferase
• Species: Photinus pyralis
• Insert Size (bp): 1700
• Promoter: T. cruzi rRNA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCAAAAAGGGAAGTGAGCAAAA

Resource Information

• Supplemental Documents:
  • Annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Industry MTA
  • Luciferase Limited Use Label License for Distribution to Industry