Gal1/10 Ura S. cerevisiae expression vector (12URA-U)
(Plasmid #48306)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: Series-12: S cerevisiae Expression Vectors (unpublished)

Backbone

• Vector backbone: pRS426
• Backbone size (bp): 8878
• Vector type: NA

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Resource Information

• Supplemental Documents:
  • Gal1/10 Ura S. cerevisiae expression vector (12URA-U).ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.

This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector can complement Ura auxotrophy.

Add the following tags to your PCR primers:
Note: You must add an ATG to the beginning of your open reading frame.
LICvBac Forward Tag TACTTCCAATCCAATCG
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.

Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).

For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/