Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Gal1/10 Ura S. cerevisiae expression vector (12URA-U)
(Plasmid #48306)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48306 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS426
  • Backbone size (bp) 8878
  • Vector type
    NA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.

This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector can complement Ura auxotrophy.

Add the following tags to your PCR primers:
Note: You must add an ATG to the beginning of your open reading frame.
LICvBac Forward Tag TACTTCCAATCCAATCG
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.

Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).

For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Gal1/10 Ura S. cerevisiae expression vector (12URA-U) was a gift from Scott Gradia (Addgene plasmid # 48306 ; http://n2t.net/addgene:48306 ; RRID:Addgene_48306)