Skip to main content
Addgene

pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc)
(Plasmid #48285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 4755
  • Vector type
    Bacterial Expression
  • Tag / Fusion Protein
    • His6 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV cleavable His6 fusion tag on the C-terminus.

To clone into this vector, add LIC version 3 fusion tags to the 5' end of your PCR primers.
Forward - 5'TTTAAGAAGGAGATATAGTTC3'
Reverse - 5'GGATTGGAAGTAGAGGTTCTC3'

In addition, ensure that your open reading frame contains an ATG start codon.

Linearize the plasmid with HpaI and gel purify.

When digesting the DNA with T4 polymerase for LIC version 3, use dGTP for insert and dCTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc) was a gift from Scott Gradia (Addgene plasmid # 48285 ; http://n2t.net/addgene:48285 ; RRID:Addgene_48285)