-
PurposeHydrogen peroxide insensitive version of HyPerRed to be used as a pH control in HyPer experiments.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3975
- Total vector size (bp) 5406
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHYPER-RED-C199S
-
Alt nameSYPHER-RED
-
SpeciesSynthetic
-
Insert Size (bp)1431
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-HyPer-Red-C199S was a gift from Vsevolod Belousov (Addgene plasmid # 48252 ; http://n2t.net/addgene:48252 ; RRID:Addgene_48252) -
For your References section:
Red fluorescent genetically encoded indicator for intracellular hydrogen peroxide. Ermakova YG, Bilan DS, Matlashov ME, Mishina NM, Markvicheva KN, Subach OM, Subach FV, Bogeski I, Hoth M, Enikolopov G, Belousov VV. Nat Commun. 2014 Oct 21;5:5222. doi: 10.1038/ncomms6222. 10.1038/ncomms6222 PubMed 25330925