-
PurposedCas9VP64 on pmax expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmax-DEST (Addgene: 48222)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9(D10A;H840A) fusion with VP64 activation domain
-
Alt namedCas9VP64
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)4409
-
MutationD10A;H840A (catalytically inactive)
- Promoter CAGGS
-
Tags
/ Fusion Proteins
- HA Tag (N terminal on insert)
- VP64 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gggcttgtcgagacagagaagat
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information including protocols and
updates, please go to http://www.crispr-on.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC91-pmax-dCas9VP64 was a gift from Rudolf Jaenisch (Addgene plasmid # 48223 ; http://n2t.net/addgene:48223 ; RRID:Addgene_48223) -
For your References section:
Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020