Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CAG-GFP-IRES-CRE
(Plasmid #48201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48201 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CAG-GFP
  • Backbone manufacturer
    Gage lab (Addgene plasmid# 16664)
  • Backbone size w/o insert (bp) 6764
  • Total vector size (bp) 9328
  • Modifications to backbone
    vector backbone based on the pCL system by Naviaux et al.,J. Virol. 70, 5701–5705 (1996).
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    eGFP
  • Alt name
    Enhanced Green Fluorescent Protein
  • Alt name
    N/A
  • Alt name
    N/A
  • Species
    Aequorea victoria green
  • Insert Size (bp)
    700
  • GenBank ID
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CTC GGC AAC GTG CTG GTT GTT
  • 3′ sequencing primer CAACATAGTTAAGAATACCAGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cre
  • Alt name
    Cre-recombinase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    991
  • GenBank ID
  • Promoter linked by IRES

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-GFP-IRES-CRE was a gift from Fred Gage (Addgene plasmid # 48201 ; http://n2t.net/addgene:48201 ; RRID:Addgene_48201)
  • For your References section:

    Distinct morphological stages of dentate granule neuron maturation in the adult mouse hippocampus. Zhao C, Teng EM, Summers RG, Ming GL, Gage FH. J Neurosci. 2006 Jan 4. 26(1):3-11. 10.1523/JNEUROSCI.3648-05.2006 PubMed 16399667