Skip to main content
Addgene

pCAG-VSFP Butterfly 1.2
(Plasmid #47978)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47978 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone manufacturer
    custom
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSFP Butterfly 1.2
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AflII (unknown if destroyed)
  • 5′ sequencing primer atgaggagccgctttgtgaagaaagatggtcattgcaatgttcagtttatcaacgtgatggtgtctaaggg
  • 3′ sequencing primer gaccgccgccgggatcactctcggcatggacgagctgtacaagtaag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-VSFP Butterfly 1.2 was a gift from Thomas Knopfel (Addgene plasmid # 47978 ; http://n2t.net/addgene:47978 ; RRID:Addgene_47978)

  • For your References section:

    Imaging neural circuit dynamics with a voltage-sensitive fluorescent protein. Akemann W, Mutoh H, Perron A, Park YK, Iwamoto Y, Knopfel T. J Neurophysiol. 2012 Oct;108(8):2323-37. doi: 10.1152/jn.00452.2012. Epub 2012 Jul 18. 10.1152/jn.00452.2012 PubMed 22815406
Related items:
Commonly requested with: