TALEN_C18
(Plasmid #47974)

• Purpose: Golden Gate Compatible TALEN Construct site specific modification of genome, shortened C Terminus, Codon Optimized FokI
• Depositing Lab: Gang Bao
• Publication: Bao Lab Golden Gate plasmids (unpublished)

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6918
• Modifications to backbone: Addition of TALEN motif with truncated C-Terminus
• Vector type: Mammalian Expression, TALEN
• Selectable markers: Neomycin (select with G418) ; XGAL/IPTG

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: LB+antibiotics
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Transcription Activator Like Effector Nuclease
• Alt name: TALEN
• Species: Xanthamonas oryzae
• Insert Size (bp): 1490
• Mutation: Shortened C-Terminus,Codon Optimized FokI Endonuclease
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (not destroyed)
• 3′ cloning site: BsmBI (not destroyed)
• 5′ sequencing primer: GTAACAGCGGTAGAGGCAGTG
• 3′ sequencing primer: CGCTCTTCACCAGCTGGGATCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We modified the MR15 backbone provided by the Porteus lab at the Stanford University School of Medicine.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

MR15 is a designation vector for the Cermak et al Golden Gate system designed for expression in mammalian cells.

Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 47974" in your Materials and Methods section.