CS2-Myc-hASUN
(Plasmid
#47955)
-
PurposeExpression of tagged-human ASUN
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCS2
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 7100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsunder
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
Entrez GeneINTS13 (a.k.a. ASUN, C12orf11, GCT1, Mat89Bb, NET48, SPATA30)
- Promoter Sp6
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atgaagattttttctgaatct
- 3′ sequencing primer ggaaaagccagcc ggcagtga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CS2-Myc-hASUN was a gift from Laura Lee (Addgene plasmid # 47955 ; http://n2t.net/addgene:47955 ; RRID:Addgene_47955) -
For your References section:
Nuclear-localized Asunder regulates cytoplasmic dynein localization via its role in the Integrator complex. Jodoin JN, Sitaram P, Albrecht TR, May SB, Shboul M, Lee E, Reversade B, Wagner EJ, Lee LA. Mol Biol Cell. 2013 Jul 31. 10.1091/mbc.E13-05-0254 PubMed 23904267