pOTTC476 - pAAV c-fos eYFP
(Plasmid #47907)

• Purpose: An AAV vector that expresses eYFP under the c-fos promoter.
• Depositing Lab: Brandon Harvey
• Publication: Richie et al J Neurosci Methods. 2017 Jun 1;284:1-14. doi: 10.1016/j.jneumeth.2017.03.020. Epub 2017 Apr 2.

Backbone

• Vector backbone: pAAV CaMKIIa hChR2-EYFP
• Backbone manufacturer: Karl Deisseroth
• Modifications to backbone: the CaMKIIa promoter and hChR2 ORF were replaced with the promoter and first two exons of c-fos from fosGFP.
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: enhanced Yellow Fluorescent Protein
• Alt name: eYFP
• GenBank ID:
• Promoter: c-fos

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (unknown if destroyed)
• 3′ cloning site: NcoI (unknown if destroyed)
• 5′ sequencing primer: c-fos int1 F625 (5'-GGAAGACATAAGCAGTCTCTGACCG )
• 3′ sequencing primer: WPRE_R1 (5'ATGAAAGCCATACGGGAAGC)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: the backbone was obtained from Karl Deiserroth, but is also available from Addgene (Plasmid 26969). the c-fos promoter was obtained from fosGFP (Barth et al, The Journal of Neuroscience, July 21, 2004•24(29):6466 – 6475).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that the "N" in the depositor's sequences is legitimately ambiguous in both the Addgene stock and the depositor's original stock. This repeat region may vary in different preps of the plasmid, but it should not affect the plasmid function.