-
PurposeTALE-mClover against telomere sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTALYM3
-
Vector typeMammalian Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SURE
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALE-mClover
- Promoter CAG
-
Tag
/ Fusion Protein
- mClover (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer catcgcgcaatgcactgac
- 3′ sequencing primer ggcgacgaggtggtcgttgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTALYM3-Telo1 was a gift from Maria-Elena Torres-Padilla (Addgene plasmid # 47883 ; http://n2t.net/addgene:47883 ; RRID:Addgene_47883) -
For your References section:
Live visualization of chromatin dynamics with fluorescent TALEs. Miyanari Y, Ziegler-Birling C, Torres-Padilla ME. Nat Struct Mol Biol. 2013 Oct 6. doi: 10.1038/nsmb.2680. 10.1038/nsmb.2680 PubMed 24096363