Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTALYM3B15
(Plasmid #47878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47878 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTALYM3
  • Vector type
    Mammalian Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    SURE
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALE-mClover
  • Promoter CAG
  • Tag / Fusion Protein
    • mClover (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer catcgcgcaatgcactgac
  • 3′ sequencing primer ggcgacgaggtggtcgttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTALYM3B15 was a gift from Maria-Elena Torres-Padilla (Addgene plasmid # 47878 ; http://n2t.net/addgene:47878 ; RRID:Addgene_47878)
  • For your References section:

    Live visualization of chromatin dynamics with fluorescent TALEs. Miyanari Y, Ziegler-Birling C, Torres-Padilla ME. Nat Struct Mol Biol. 2013 Oct 6. doi: 10.1038/nsmb.2680. 10.1038/nsmb.2680 PubMed 24096363