pAC-EsaR-EsaI
(Plasmid #47660)

• Purpose: esaI gene downstream of esaR in pAC-EsaR (CmR)
• Depositing Lab: Cynthia Collins
• Publication: Shong et al ACS Synth Biol. 2013 Jul 23.

Backbone

• Vector backbone: pAC-EsaR
• Backbone size w/o insert (bp): 4511
• Total vector size (bp): 5332
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: esaI-term
• Insert Size (bp): 821
• GenBank ID:
• Promoter: Plac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: tattacgctgatgtccggcctgc
• 3′ sequencing primer: gttgaaggctctcaagggcatcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A DNA fragment containing a ribosome binding site, codon-optimized esaI, and transcriptional terminator was commercially synthesized and cloned downstream of esaR between BamHI and SalI sites in pAC-EsaR.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

esaI is 636 bp and indicated as lowercase letters in the partial sequence (between BamHI and XhoI sites). See pAC-EsaR for lac promoter and esaR sequence information.