pAC-EsaR-V220A
(Plasmid #47645)

• Purpose: pAC-EsaR with a c659t mutation in esaR
• Depositing Lab: Cynthia Collins
• Publication: Shong et al ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6.

Backbone

• Vector backbone: pAC-EsaR
• Backbone size w/o insert (bp): 3880
• Total vector size (bp): 4652
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: esaR-V220A
• Insert Size (bp): 772
• Mutation: Changed Valine 220 to Alanine
• GenBank ID:
• Promoter: Plac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gattacgcgcagaccaaaacgatc
• 3′ sequencing primer: gttgaaggctctcaagggcatcg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

esaR-V220A (750bp, indicated as lowercase letters in the partial sequence) is located between KpnI and BamHI sites in the same way as wt esaR in pAC-EsaR. Please see pAC-EsaR for lac promoter and terminator sequence information and plasmid map.