pAC-EsaR
(Plasmid #47643)

• Purpose: wt esaR gene under control of Plac in pACYC184
• Depositing Lab: Cynthia Collins
• Publication: Shong et al ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6.

Backbone

• Vector backbone: pACYC184
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 3518
• Total vector size (bp): 4652
• Modifications to backbone: The tetracycline resistance gene in pACYC184 was removed.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Plac-esaR-terminator
• Insert Size (bp): 1134
• GenBank ID:
• Promoter: Plac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: gattacgcgcagaccaaaacgatc
• 3′ sequencing primer: gttgaaggctctcaagggcatcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We amplified the esaR gene from pTDM6 (Minogue, TD et al., 2002, Mol. Microbiol.).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pAC-EsaR is an esaR expression vector. The esaR gene (750 bp, indicated as lowercase letters in the partial sequence for wt EsaR between KpnI and BamHI) is flanked by KpnI and BamHI sites.