pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)
(Plasmid #47550)

• Purpose: Cas9 + sgRNA plasmid that is targeted to a genomic site near the ttTi5605 Mos1 insertion allele
• Depositing Lab: Bob Goldstein
• Publication: Dickinson et al Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641.

Backbone

• Vector backbone: pCFJ601
• Backbone size w/o insert (bp): 2300
• Total vector size (bp): 8132
• Modifications to backbone: Generated from pCFJ601 by replacing the Mos1 transposase with Cas9, then inserting the U6 Promoter::sgRNA gene. Cloning method was Gibson Assembly
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Mach1
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Synthetic
• Insert Size (bp): 4323
• Mutation: Codon optimized and with synthetic introns for C. elegans
• Promoter: eef-1A.1 (eft-3)
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TCAGTTGGGAAACACTTTGCT
• 3′ sequencing primer: gcttgaaaggattttgcatttatc

Gene/Insert 2

• Gene/Insert name: ttTi5605 sgRNA
• Insert Size (bp): 100
• Mutation: Protospacer targeting a genomic site adjacent to the ttTi5605 Mos1 allele
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: N/A
• 3′ sequencing primer: ggtgtgaaataccgcacaga

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)
• A portion of this plasmid was derived from a plasmid made by: The vector backbone, pCFJ601, was received from Addgene. The insert was synthesized in our lab.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/

gRNA target sequence atatcagtctgtttcgtaa

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3