Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FLAG-KIF17-short-pcDNA3
(Plasmid #47545)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47545 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5546
  • Total vector size (bp) 7027
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF17-short
  • Alt name
    Kinesin 17
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1536
  • Mutation
    G152S*
  • GenBank ID
    BAE43328.1 AK046890.1
  • Entrez Gene
    Kif17 (a.k.a. 5930435E01Rik, AW492270, Kif17b, mKIAA1405)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG epitope (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CTAGAGAACCCACTGCTTACTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCTGATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector directs expression of neither of the current mouse RefSeq Kif17 variants, isoform 1 or isoform 2. Rather the vector expresses a cDNA which corresponds to a different alternatively spliced transcript encoding a still shorter isoform of 511 amino acids rather than the 1038 residues of isoform 1 or 710 of isoform 2. The first 400 residues of the “short” isoform are essentially identical to the amino-terminal motor domain of isoform 1 and 2. Based on studies of Kif17 truncations, the short form of mouse Kif17 is predicted to form dimers and to bind microtubules.

*Compared to the reference sequence, this expression vector expresses a protein with substitution of conserved glycine-152 with a serine in the motor domain of Kif17. Due to this mutation, the properties of the produced protein could be altered.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-KIF17-short-pcDNA3 was a gift from Richard Maurer (Addgene plasmid # 47545 ; http://n2t.net/addgene:47545 ; RRID:Addgene_47545)