FLAG-KIF17-short-pcDNA3
(Plasmid #47545)

• Purpose: Expresses FLAG epitope-tagged short form of mouse KIF17 in mammalian cells
• Depositing Lab: Richard Maurer
• Publication: FLAG-KIF17-Short-pcDNA3 (unpublished)

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5546
• Total vector size (bp): 7027
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KIF17-short
• Alt name: Kinesin 17
• Species: M. musculus (mouse)
• Insert Size (bp): 1536
• Mutation: G152S*
• GenBank ID: BAE43328.1 AK046890.1
• Entrez Gene: Kif17 (a.k.a. 5930435E01Rik, AW492270, Kif17b, mKIAA1405)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG epitope (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CTAGAGAACCCACTGCTTACTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGGCTGATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This vector directs expression of neither of the current mouse RefSeq Kif17 variants, isoform 1 or isoform 2. Rather the vector expresses a cDNA which corresponds to a different alternatively spliced transcript encoding a still shorter isoform of 511 amino acids rather than the 1038 residues of isoform 1 or 710 of isoform 2. The first 400 residues of the “short” isoform are essentially identical to the amino-terminal motor domain of isoform 1 and 2. Based on studies of Kif17 truncations, the short form of mouse Kif17 is predicted to form dimers and to bind microtubules.

*Compared to the reference sequence, this expression vector expresses a protein with substitution of conserved glycine-152 with a serine in the motor domain of Kif17. Due to this mutation, the properties of the produced protein could be altered.