Skip to main content
Addgene

Tet-pLKO-puro-Scrambled
(Plasmid #47541)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47541 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone size w/o insert (bp) 10633
  • Total vector size (bp) 8775
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scrambled shRNA
  • gRNA/shRNA sequence
    CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
  • Species
    Synthetic
  • Promoter H1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer H1
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tet-pLKO-puro-Scrambled was a gift from Charles Rudin (Addgene plasmid # 47541 ; http://n2t.net/addgene:47541 ; RRID:Addgene_47541)

  • For your References section:

    Comprehensive genomic analysis identifies SOX2 as a frequently amplified gene in small-cell lung cancer. Rudin CM, Durinck S, Stawiski EW, Poirier JT, Modrusan Z, Shames DS, Bergbower EA, Guan Y, Shin J, Guillory J, Rivers CS, Foo CK, Bhatt D, Stinson J, Gnad F, Haverty PM, Gentleman R, Chaudhuri S, Janakiraman V, Jaiswal BS, Parikh C, Yuan W, Zhang Z, Koeppen H, Wu TD, Stern HM, Yauch RL, Huffman KE, Paskulin DD, Illei PB, Varella-Garcia M, Gazdar AF, de Sauvage FJ, Bourgon R, Minna JD, Brock MV, Seshagiri S. Nat Genet. 2012 Oct;44(10):1111-6. doi: 10.1038/ng.2405. Epub 2012 Sep 2. 10.1038/ng.2405 PubMed 22941189
Related items:
Commonly requested with: