pAraTMwt
(Plasmid #47514)

• Purpose: Contains A2B L980A TMCY mutant, expresses wt AraC for heterodimer competition assay
• Depositing Lab: Bryan Berger
• Publication: Su et al J Mol Biol. 2013 Jul 19. pii: S0022-2836(13)00456-7. doi: 10.1016/j.jmb.2013.07.022.

Backbone

• Vector backbone: pTrc99
• Total vector size (bp): 5611
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Integrin alpha2B L980A TM-CYTO
• Species: Synthetic
• Insert Size (bp): 138
• Promoter: Tac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: gcgctgaagtcttacgagga
• 3′ sequencing primer: TTATGACAACTTGACGGCTACATC

Resource Information

• Supplemental Documents:
  • Annotated sequence file for pAraTMWT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Addgene QC sequence identifed a S23P mutation in the MBP insert that does not effect plasmid function.