pFYF1320 EGFP Site#1
(Plasmid #47511)

• Purpose: human gRNA expression vector targeting EGFP
• Depositing Lab: Keith Joung
• Publication: Fu et al Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.

Backbone

• Vector backbone: MLM3636
• Backbone manufacturer: Joung lab (Addgene plasmid #43860)
• Backbone size w/o insert (bp): 2278
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNA-EGFP site 1
• Species: Synthetic
• Insert Size (bp): 20
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (not destroyed)
• 3′ cloning site: BsmBI (not destroyed)
• 5′ sequencing primer: hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Target site: GGGCACGGGCAGCTTGCCGG

gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)

For more information on Joung Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/jounglab/