5HT6-CFP-Venus(H148G)
(Plasmid #47501)

• Purpose: Fluorescent reporter for pH inside primary cilia
• Depositing Lab: Takanari Inoue
• Publication: Su et al Nat Methods. 2013 Sep 22. doi: 10.1038/nmeth.2647.

Backbone

• Vector backbone: pECFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 6700
• Modifications to backbone: DNA encoding 5HT6 flanked by NheI and AgeI was amplified by PCR from 5HT6-GFP and then subcloned into pECFP vector (Clontech).
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Venus(H148G)
• Species: Synthetic
• Insert Size (bp): 720
• Mutation: H148G mutation
• Tags / Fusion Proteins:
  • 5HT6 (N terminal on backbone)
  • CFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: None
• 3′ sequencing primer: CCTCTACAAATGTGGTATGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry