AU1-TTC30A2-pcDNA3
(Plasmid
#47324)
-
PurposeExpresses AU1 epitope-tagged TTC30A2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5546
- Total vector size (bp) 7504
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTTC30A2
-
SpeciesM. musculus (mouse)
-
Entrez GeneTtc30a2 (a.k.a. RP23-179N22.2, OTTMUSG00000015167)
- Promoter CMV
-
Tag
/ Fusion Protein
- AU1 epitope (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTAGAGAACCCACTGCTTACTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCTGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AU1-TTC30A2-pcDNA3 was a gift from Richard Maurer (Addgene plasmid # 47324 ; http://n2t.net/addgene:47324 ; RRID:Addgene_47324) -
For your References section:
Interaction of mouse TTC30/DYF-1 with multiple intraflagellar transport complex B proteins and KIF17. Howard PW, Jue SF, Maurer RA. Exp Cell Res. 2013 Jun 25. pii: S0014-4827(13)00271-1. doi: 10.1016/j.yexcr.2013.06.010. 10.1016/j.yexcr.2013.06.010 PubMed 23810713