Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZH051
(Plasmid #47311)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47311 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 4225
  • Total vector size (bp) 9600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    can grow at 30C, 37C or RT
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    wild type immunity region of lambda phage with tsr-venus-ub-cI
  • Insert Size (bp)
    5375
  • Promoter PR; PRM
  • Tag / Fusion Protein
    • CI (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctatcgactacgcgatcatgg
  • 3′ sequencing primer cgatcttccccatcggtgatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZH051 was a gift from Jie Xiao (Addgene plasmid # 47311 ; http://n2t.net/addgene:47311 ; RRID:Addgene_47311)
  • For your References section:

    Stochastic expression dynamics of a transcription factor revealed by single-molecule noise analysis. Hensel Z, Feng H, Han B, Hatem C, Wang J, Xiao J. Nat Struct Mol Biol. 2012 Aug;19(8):797-802. doi: 10.1038/nsmb.2336. Epub 2012 Jul 1. 10.1038/nsmb.2336 PubMed 22751020