CS2-Myc-mASUN
(Plasmid
#47044)
-
PurposeExpression of tagged-mouse ASUN
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCS2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAsunder
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2100
-
Entrez GeneAsun (a.k.a. RP23-158O11.1, 4933424B01Rik, Spata30)
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Fse1 (not destroyed)
- 3′ cloning site Asc1 (not destroyed)
- 5′ sequencing primer atgaagattttttctgaatct
- 3′ sequencing primer gggaaagccagccgccagtga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CS2-Myc-mASUN was a gift from Laura Lee (Addgene plasmid # 47044 ; http://n2t.net/addgene:47044 ; RRID:Addgene_47044) -
For your References section:
Human Asunder promotes dynein recruitment and centrosomal tethering to the nucleus at mitotic entry. Jodoin JN, Shboul M, Sitaram P, Zein-Sabatto H, Reversade B, Lee E, Lee LA. Mol Biol Cell. 2012 Dec;23(24):4713-24. doi: 10.1091/mbc.E12-07-0558. Epub 2012 Oct 24. 10.1091/mbc.E12-07-0558 PubMed 23097494