Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CS2-HA-dASUN
(Plasmid #47041)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47041 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CS2
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Asunder
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    2100
  • Entrez Gene
    asun (a.k.a. Dmel_CG6814, ASUN, Asu, Asun, CG6814, Dmel\CG6814, IntS13, Mat89Bb)
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Fse1 (not destroyed)
  • 3′ cloning site Asc1 (not destroyed)
  • 5′ sequencing primer atgttcgaacgcaaccagaag
  • 3′ sequencing primer gaggaatccgtacgtagttaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CS2-HA-dASUN was a gift from Laura Lee (Addgene plasmid # 47041 ; http://n2t.net/addgene:47041 ; RRID:Addgene_47041)
  • For your References section:

    Human Asunder promotes dynein recruitment and centrosomal tethering to the nucleus at mitotic entry. Jodoin JN, Shboul M, Sitaram P, Zein-Sabatto H, Reversade B, Lee E, Lee LA. Mol Biol Cell. 2012 Dec;23(24):4713-24. doi: 10.1091/mbc.E12-07-0558. Epub 2012 Oct 24. 10.1091/mbc.E12-07-0558 PubMed 23097494