TV3-mCHY-dASUN
(Plasmid
#47034)
-
PurposeDrosophila testes specific expression of fluorescent dASUN
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47034 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTV3
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAsunder
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)2100
-
Entrez Geneasun (a.k.a. Dmel_CG6814, ASUN, Asu, Asun, CG6814, Dmel\CG6814, IntS13, Mat89Bb)
-
Tag
/ Fusion Protein
- mCHY (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Fse1 (not destroyed)
- 3′ cloning site Asc1 (not destroyed)
- 5′ sequencing primer atgttcgaacgcaaccagaag
- 3′ sequencing primer gaggaatccgtacgtagttaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TV3-mCHY-dASUN was a gift from Laura Lee (Addgene plasmid # 47034 ; http://n2t.net/addgene:47034 ; RRID:Addgene_47034) -
For your References section:
Asunder is a critical regulator of dynein-dynactin localization during Drosophila spermatogenesis. Anderson MA, Jodoin JN, Lee E, Hales KG, Hays TS, Lee LA. Mol Biol Cell. 2009 Jun;20(11):2709-21. doi: 10.1091/mbc.E08-12-1165. Epub 2009 Apr 8. 10.1091/mbc.e08-12-1165 PubMed 19357193