Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMX-Brn4
(Plasmid #47028)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47028 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMX
  • Backbone size w/o insert (bp) 5871
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Brn4
  • Alt name
    Pou3f4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1085
  • Mutation
    The insert includes 40 bp of the TOPO vector in the 5 end
  • GenBank ID
    NM_008901
  • Entrez Gene
    Pou3f4 (a.k.a. Brn-4, Brn4, OTF-9, Otf9, Slf, oct-9)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer TCCCCCCTTTTTCTGGAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX-Brn4 was a gift from Hans Schöler (Addgene plasmid # 47028 ; http://n2t.net/addgene:47028 ; RRID:Addgene_47028)
  • For your References section:

    Direct reprogramming of fibroblasts into neural stem cells by defined factors. Han DW, Tapia N, Hermann A, Hemmer K, Hoing S, Arauzo-Bravo MJ, Zaehres H, Wu G, Frank S, Moritz S, Greber B, Yang JH, Lee HT, Schwamborn JC, Storch A, Scholer HR. Cell Stem Cell. 2012 Apr 6;10(4):465-72. doi: 10.1016/j.stem.2012.02.021. Epub 2012 Mar 22. 10.1016/j.stem.2012.02.021 PubMed 22445517