Skip to main content
Addgene

pGEX6P1-3xMBT_D355N
(Plasmid #46988)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46988 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6P-1
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 5987
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Protein expression with 0.1 mM IPTG added during log-phase growth and incubated overnight at 20C.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Triple MBT domain from human L3MBTL1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1023
  • Mutation
    Mutation aspartic acid 355 to asparagine (D355N); contains amino acids 190–530 of NP_056293.4
  • GenBank ID
    NM_015478.6
  • Entrez Gene
    L3MBTL1 (a.k.a. H-L(3)MBT, L3MBTL, ZC2HC3, dJ138B7.3)
  • Promoter tac
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • PreScission cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer 5'-d[GGGCTGGCAAGCCACGTTTGGTG]-3'
  • 3′ sequencing primer 5'-d[CCGGGAGCTGCATGTGTCAGAGG]-3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32.

Please note that Addgene's sequencing results found a 23bp insert between bp# 1975/1976 when compared to the full plasmid sequence. The extra sequence is a second stop codon and an EcoRI site, followed by part of the MCS.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-3xMBT_D355N was a gift from Or Gozani (Addgene plasmid # 46988 ; http://n2t.net/addgene:46988 ; RRID:Addgene_46988)
  • For your References section:

    A general molecular affinity strategy for global detection and proteomic analysis of lysine methylation. Moore KE, Carlson SM, Camp ND, Cheung P, James RG, Chua KF, Wolf-Yadlin A, Gozani O. Mol Cell. 2013 May 9;50(3):444-56. doi: 10.1016/j.molcel.2013.03.005. Epub 2013 Apr 11. 10.1016/j.molcel.2013.03.005 PubMed 23583077