pGEX6P1-3xMBT
(Plasmid #46987)

• Purpose: Inducible expression of 3xMBT from L3MBTL1 as a GST fusion protein in E.coli
• Depositing Lab: Or Gozani
• Publication: Moore et al Mol Cell. 2013 May 9;50(3):444-56. doi: 10.1016/j.molcel.2013.03.005. Epub 2013 Apr 11.

Backbone

• Vector backbone: pGEX-6P-1
• Backbone manufacturer: GE Healthcare
• Backbone size w/o insert (bp): 4984
• Total vector size (bp): 5987
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Protein expression with 0.1 mM IPTG added during log-phase growth and incubated overnight at 20C.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Triple MBT domain from human L3MBTL1
• Species: H. sapiens (human)
• Insert Size (bp): 1023
• Mutation: contains amino acids 190–530 of accession NP_056293.4
• GenBank ID: NM_015478.6 NP_056293.4
• Entrez Gene: L3MBTL1 (a.k.a. H-L(3)MBT, L3MBTL, ZC2HC3, dJ138B7.3)
• Promoter: tac
• Tags / Fusion Proteins:
  • GST (N terminal on backbone)
  • PreScission cleavage site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: 5'-d[GGGCTGGCAAGCCACGTTTGGTG]-3'
• 3′ sequencing primer: 5'-d[CCGGGAGCTGCATGTGTCAGAGG]-3'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32.