pICE-EGFP-FLAG-Ku70siR-WT
(Plasmid #46961)

• Purpose: Plasmid for constitutive or doxycycline-inducible expression of wild-type human Ku70 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.
• Depositing Lab: Steve Jackson
• Publication: Britton et al J Cell Biol. 2013 Jul 29.

Backbone

• Vector backbone: pICE
• Backbone size w/o insert (bp): 5044
• Total vector size (bp): 7570
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Ku70
• Alt name: XRCC6
• Species: H. sapiens (human)
• Insert Size (bp): 1830
• GenBank ID: NM_001469.3
• Entrez Gene: XRCC6 (a.k.a. CTC75, CTCBF, G22P1, KU70, ML8, TLAA)
• Promoter: CMV Tet
• Tag / Fusion Protein:
  • GFP-FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: GTAGGCGTGTACGGTGGGAGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • Author annotated GenBank sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry